Transcript: Human NM_001080467.3

Homo sapiens myosin VB (MYO5B), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MYO5B (4645)
Length:
9583
CDS:
355..5901

Additional Resources:

NCBI RefSeq record:
NM_001080467.3
NBCI Gene record:
MYO5B (4645)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254076 TGGTGATTCCTGTAGTATATC pLKO_005 1389 CDS 100% 13.200 18.480 N MYO5B n/a
2 TRCN0000265463 ACGATTCTGGAATACCCAATT pLKO_005 490 CDS 100% 10.800 15.120 N MYO5B n/a
3 TRCN0000265464 GCGTGTTACAGCCGATGATAG pLKO_005 5186 CDS 100% 10.800 15.120 N MYO5B n/a
4 TRCN0000254077 TAATCAGTTCAGGGATATTAT pLKO_005 6912 3UTR 100% 15.000 10.500 N MYO5B n/a
5 TRCN0000265458 CAAGTATGCCATGCGCTATTT pLKO_005 873 CDS 100% 13.200 9.240 N MYO5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.