Transcript: Human NM_001080482.4

Homo sapiens apical junction component 1 homolog (AJM1), mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
AJM1 (389813)
Length:
3186
CDS:
256..3186

Additional Resources:

NCBI RefSeq record:
NM_001080482.4
NBCI Gene record:
AJM1 (389813)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080482.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272350 TCAACGCCTGCCTCTACTTCA pLKO_005 2285 CDS 100% 4.950 3.960 N AJM1 n/a
2 TRCN0000272296 AGATCACCATCACTGACAATG pLKO_005 1850 CDS 100% 10.800 7.560 N AJM1 n/a
3 TRCN0000272349 CAACGAGCTGCATCCCATCAA pLKO_005 684 CDS 100% 4.950 3.465 N AJM1 n/a
4 TRCN0000284723 CCACAGCTGCTACACCTACTA pLKO_005 2313 CDS 100% 4.950 3.465 N AJM1 n/a
5 TRCN0000281889 CTACGAGCAGCTTTGCGAGTT pLKO_005 3015 CDS 100% 4.050 2.835 N AJM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080482.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.