Transcript: Human NM_001080489.3

Homo sapiens glyoxalase domain containing 5 (GLOD5), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GLOD5 (392465)
Length:
740
CDS:
45..527

Additional Resources:

NCBI RefSeq record:
NM_001080489.3
NBCI Gene record:
GLOD5 (392465)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080489.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245716 TTCCTGGCTCCCTGGACATAT pLKO_005 334 CDS 100% 13.200 9.240 N GLOD5 n/a
2 TRCN0000245717 ACATCGTGATGACGGTGAAGA pLKO_005 163 CDS 100% 4.950 3.465 N GLOD5 n/a
3 TRCN0000245715 CCATGTCTTATCCGTAGACTT pLKO_005 138 CDS 100% 4.950 3.465 N GLOD5 n/a
4 TRCN0000257447 TGGGCATGGAGGTCATGACTT pLKO_005 220 CDS 100% 4.950 3.465 N GLOD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080489.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.