Transcript: Human NM_001080516.1

Homo sapiens glutaredoxin and cysteine rich domain containing 2 (GRXCR2), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
GRXCR2 (643226)
Length:
747
CDS:
1..747

Additional Resources:

NCBI RefSeq record:
NM_001080516.1
NBCI Gene record:
GRXCR2 (643226)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255830 CTCCTACAGCGGTCGAGTATT pLKO_005 75 CDS 100% 13.200 18.480 N GRXCR2 n/a
2 TRCN0000255831 GACCAGCACGATAGACCTTTG pLKO_005 502 CDS 100% 6.000 8.400 N GRXCR2 n/a
3 TRCN0000265676 CCAGCCTCGGTTCAACGATTA pLKO_005 297 CDS 100% 10.800 8.640 N GRXCR2 n/a
4 TRCN0000371062 TCTGCAAGAGTCTCTTGAAAC pLKO_005 159 CDS 100% 10.800 8.640 N GRXCR2 n/a
5 TRCN0000255829 TTTGAGGATGGGCAGGAATTA pLKO_005 106 CDS 100% 13.200 9.240 N GRXCR2 n/a
6 TRCN0000255828 GTGTGTTTAGAGAGGGTAATG pLKO_005 257 CDS 100% 10.800 7.560 N GRXCR2 n/a
7 TRCN0000371053 ATCAGAAGAGTGATGGCAAAC pLKO_005 26 CDS 100% 6.000 4.200 N GRXCR2 n/a
8 TRCN0000371052 TTTGGAAAGATAATCATCTAC pLKO_005 355 CDS 100% 4.950 3.465 N GRXCR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.