Transcript: Mouse NM_001081084.2

Mus musculus cubilin (intrinsic factor-cobalamin receptor) (Cubn), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Mus musculus (mouse)
Gene:
Cubn (65969)
Length:
11339
CDS:
64..10935

Additional Resources:

NCBI RefSeq record:
NM_001081084.2
NBCI Gene record:
Cubn (65969)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081084.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253442 CGGCATACTGACTGGTAATTA pLKO_005 1836 CDS 100% 15.000 21.000 N Cubn n/a
2 TRCN0000253444 ATCCGTGATTACGCGAGAAAT pLKO_005 7831 CDS 100% 13.200 18.480 N Cubn n/a
3 TRCN0000253440 TGAACTAGCAATCCGATTTAA pLKO_005 4509 CDS 100% 15.000 10.500 N Cubn n/a
4 TRCN0000253441 CACGAAGGAAGGCAGATTATC pLKO_005 7516 CDS 100% 13.200 9.240 N Cubn n/a
5 TRCN0000253443 TCCTTACTGGATGCACCATTT pLKO_005 11159 3UTR 100% 10.800 7.560 N Cubn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081084.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.