Transcript: Mouse NM_001081088.1

Mus musculus low density lipoprotein receptor-related protein 2 (Lrp2), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Lrp2 (14725)
Length:
15467
CDS:
175..14157

Additional Resources:

NCBI RefSeq record:
NM_001081088.1
NBCI Gene record:
Lrp2 (14725)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240608 CAAACCCAACGGGTCTAATTT pLKO_005 6558 CDS 100% 15.000 21.000 N Lrp2 n/a
2 TRCN0000240609 GACCATGACACTGGCTATATT pLKO_005 6901 CDS 100% 15.000 21.000 N Lrp2 n/a
3 TRCN0000240612 TCCATACCGGCAGCCGATTAT pLKO_005 10554 CDS 100% 13.200 18.480 N Lrp2 n/a
4 TRCN0000240610 TTAGTCACAGGACGGATAATG pLKO_005 2198 CDS 100% 13.200 18.480 N Lrp2 n/a
5 TRCN0000240611 CGGTTTCTCTGTGCTAATATT pLKO_005 15248 3UTR 100% 15.000 10.500 N Lrp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.