Transcript: Mouse NM_001081090.1

Mus musculus ESF1 nucleolar pre-rRNA processing protein homolog (Esf1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Esf1 (66580)
Length:
3392
CDS:
124..2661

Additional Resources:

NCBI RefSeq record:
NM_001081090.1
NBCI Gene record:
Esf1 (66580)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081090.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267427 AGTTGATTTAACGGCATATAA pLKO_005 1563 CDS 100% 15.000 21.000 N Esf1 n/a
2 TRCN0000252637 GCCTTGTCCATGCTGATTAAA pLKO_005 2584 CDS 100% 15.000 10.500 N Esf1 n/a
3 TRCN0000252636 CCAGTAGAGTTACTAAGTATT pLKO_005 1309 CDS 100% 13.200 9.240 N Esf1 n/a
4 TRCN0000267426 GACAGCTCTTGCAGGTTATTC pLKO_005 1853 CDS 100% 13.200 9.240 N Esf1 n/a
5 TRCN0000252638 AGATGCTATTTACAATCTATG pLKO_005 3158 3UTR 100% 10.800 7.560 N Esf1 n/a
6 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 962 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081090.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.