Transcript: Mouse NM_001081098.1

Mus musculus zinc finger protein 362 (Zfp362), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Zfp362 (230761)
Length:
2882
CDS:
190..1446

Additional Resources:

NCBI RefSeq record:
NM_001081098.1
NBCI Gene record:
Zfp362 (230761)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081098.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257313 GATGGCCGAACCTCGATTTAA pLKO_005 228 CDS 100% 15.000 21.000 N Zfp362 n/a
2 TRCN0000238489 GACAACCTGGTCCTGATTAAC pLKO_005 295 CDS 100% 13.200 10.560 N Zfp362 n/a
3 TRCN0000238488 CGCCATTGATTTACCAGTTTA pLKO_005 2632 3UTR 100% 13.200 9.240 N Zfp362 n/a
4 TRCN0000238490 TCACCAGCGCCAGCACAATAA pLKO_005 1173 CDS 100% 13.200 9.240 N Zfp362 n/a
5 TRCN0000257385 GGCAAGACATACAGGTGTAAG pLKO_005 853 CDS 100% 10.800 6.480 N Zfp362 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081098.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.