Transcript: Mouse NM_001081125.1

Mus musculus GLI-Kruppel family member GLI2 (Gli2), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Gli2 (14633)
Length:
6708
CDS:
350..4984

Additional Resources:

NCBI RefSeq record:
NM_001081125.1
NBCI Gene record:
Gli2 (14633)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081125.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226034 TCGACCTACAACGCATGATTC pLKO_005 1065 CDS 100% 10.800 15.120 N Gli2 n/a
2 TRCN0000226032 TATCTCCTTGATACGACTTTC pLKO_005 628 CDS 100% 10.800 8.640 N Gli2 n/a
3 TRCN0000226033 CACCAACCCTTCAGACTATTA pLKO_005 847 CDS 100% 13.200 9.240 N Gli2 n/a
4 TRCN0000219066 TATGTTTACCCGCTCCTATTT pLKO_005 5815 3UTR 100% 13.200 9.240 N Gli2 n/a
5 TRCN0000226035 TGTGGAGGACTGCCTACATAT pLKO_005 2206 CDS 100% 13.200 9.240 N Gli2 n/a
6 TRCN0000238361 CTGGACAGGGATGACTGTAAG pLKO_005 1550 CDS 100% 10.800 7.560 N GLI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081125.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.