Transcript: Mouse NM_001081129.1

Mus musculus contactin associated protein-like 3 (Cntnap3), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Cntnap3 (238680)
Length:
4868
CDS:
49..3912

Additional Resources:

NCBI RefSeq record:
NM_001081129.1
NBCI Gene record:
Cntnap3 (238680)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081129.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253628 CATGCAGAACAGCGGGATTAT pLKO_005 699 CDS 100% 13.200 18.480 N Cntnap3 n/a
2 TRCN0000253631 TTTCACCAGCTGACGATTAAC pLKO_005 3361 CDS 100% 13.200 18.480 N Cntnap3 n/a
3 TRCN0000265416 GTTCCTCAGTGACCTATAATT pLKO_005 3074 CDS 100% 15.000 10.500 N Cntnap3 n/a
4 TRCN0000253629 GCCAACTGTTTCTAATCATTT pLKO_005 4545 3UTR 100% 13.200 9.240 N Cntnap3 n/a
5 TRCN0000253630 GACCAGTAAGAGAGGTTATTT pLKO_005 662 CDS 100% 15.000 9.000 N Cntnap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081129.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.