Transcript: Mouse NM_001081196.1

Mus musculus heterogeneous nuclear ribonucleoprotein U-like 2 (Hnrnpul2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Hnrnpul2 (68693)
Length:
5726
CDS:
882..3119

Additional Resources:

NCBI RefSeq record:
NM_001081196.1
NBCI Gene record:
Hnrnpul2 (68693)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081196.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241134 GTTGGGTGGTTCTAGTATATA pLKO_005 3768 3UTR 100% 15.000 21.000 N Hnrnpul2 n/a
2 TRCN0000241135 TGATGTGCCTGAGTCTATAAT pLKO_005 2621 CDS 100% 15.000 21.000 N Hnrnpul2 n/a
3 TRCN0000245369 CGATTCTACAGTCGAGATTAT pLKO_005 2973 CDS 100% 13.200 18.480 N Hnrnpul2 n/a
4 TRCN0000241136 TGCCTGAGAAATGCGACTATA pLKO_005 2668 CDS 100% 13.200 10.560 N Hnrnpul2 n/a
5 TRCN0000241133 TGGGTGTGGCATTCCGAATTA pLKO_005 2023 CDS 100% 13.200 9.240 N Hnrnpul2 n/a
6 TRCN0000230596 TTGTGAACCTGGACACGTATA pLKO_005 1609 CDS 100% 10.800 7.560 N HNRNPUL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081196.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.