Transcript: Mouse NM_001081259.1

Mus musculus major facilitator superfamily domain containing 7B (Mfsd7b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Mfsd7b (226844)
Length:
4087
CDS:
98..1780

Additional Resources:

NCBI RefSeq record:
NM_001081259.1
NBCI Gene record:
Mfsd7b (226844)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081259.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251091 TTACGGGCTAGCTCGTGATTT pLKO_005 2474 3UTR 100% 13.200 18.480 N Mfsd7b n/a
2 TRCN0000251092 AGATCACAACAGACTATAATA pLKO_005 1560 CDS 100% 15.000 10.500 N Mfsd7b n/a
3 TRCN0000251089 TTCATTGGAATGCTCATATTC pLKO_005 1340 CDS 100% 13.200 9.240 N Mfsd7b n/a
4 TRCN0000251088 GCTTACAAACATTGACGTTAA pLKO_005 1684 CDS 100% 10.800 7.560 N Mfsd7b n/a
5 TRCN0000251090 TGGATGTTTGTAGGCATAATT pLKO_005 1613 CDS 100% 15.000 9.000 N Mfsd7b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081259.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.