Transcript: Mouse NM_001081340.2

Mus musculus SET domain containing 2 (Setd2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Setd2 (235626)
Length:
8350
CDS:
83..7696

Additional Resources:

NCBI RefSeq record:
NM_001081340.2
NBCI Gene record:
Setd2 (235626)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081340.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238533 ACTTTGTGAGGATAGTATAAA pLKO_005 8136 3UTR 100% 15.000 21.000 N Setd2 n/a
2 TRCN0000238535 CAAATCCCACCGGGATATTAA pLKO_005 4468 CDS 100% 15.000 21.000 N Setd2 n/a
3 TRCN0000238537 TTTGACTCTCTGGGATATAAT pLKO_005 6455 CDS 100% 15.000 10.500 N Setd2 n/a
4 TRCN0000238536 ATAGTGTGACCTCGCCTTATT pLKO_005 6918 CDS 100% 13.200 9.240 N Setd2 n/a
5 TRCN0000238534 TCAACGAAGTGGATCACATTT pLKO_005 4033 CDS 100% 13.200 9.240 N Setd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081340.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.