Transcript: Mouse NM_001081368.2

Mus musculus TBCC domain containing 1 (Tbccd1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tbccd1 (70573)
Length:
2830
CDS:
369..2027

Additional Resources:

NCBI RefSeq record:
NM_001081368.2
NBCI Gene record:
Tbccd1 (70573)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252660 GACACCTTCACGTCCACTTAT pLKO_005 1568 CDS 100% 13.200 18.480 N Tbccd1 n/a
2 TRCN0000252658 TGGTCAGTTGGTGCATAAATA pLKO_005 2611 3UTR 100% 15.000 12.000 N Tbccd1 n/a
3 TRCN0000252661 ACGCCTGGAATGGTCTGAAAT pLKO_005 635 CDS 100% 13.200 9.240 N Tbccd1 n/a
4 TRCN0000252657 TTGCTACAGTGCCTAACTATT pLKO_005 1672 CDS 100% 13.200 9.240 N Tbccd1 n/a
5 TRCN0000252659 CCCTTACGATCCATGACAATT pLKO_005 1407 CDS 100% 13.200 7.920 N Tbccd1 n/a
6 TRCN0000412663 TGCCTAACTATTGGGATAATC pLKO_005 1681 CDS 100% 13.200 18.480 N TBCCD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.