Transcript: Mouse NM_001081415.1

Mus musculus sterile alpha motif domain containing 1 (Samd1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Samd1 (666704)
Length:
2071
CDS:
1..1560

Additional Resources:

NCBI RefSeq record:
NM_001081415.1
NBCI Gene record:
Samd1 (666704)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081415.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255521 GAAATTGATGGCAAGTCTTTG pLKO_005 1402 CDS 100% 10.800 15.120 N Samd1 n/a
2 TRCN0000255523 CGCACTACCAAGAGTGGATTC pLKO_005 86 CDS 100% 6.000 8.400 N Samd1 n/a
3 TRCN0000431810 ATCTACGAGCACCACATCAAG pLKO_005 1486 CDS 100% 4.950 6.930 N SAMD1 n/a
4 TRCN0000255520 GCTCAGCACCATCAGATTAAT pLKO_005 1018 CDS 100% 15.000 10.500 N Samd1 n/a
5 TRCN0000255522 AGGACTTGGTTGGCTCATTTA pLKO_005 1754 3UTR 100% 13.200 9.240 N Samd1 n/a
6 TRCN0000265654 GTGGAGAAGAACGGGTGTTTG pLKO_005 899 CDS 100% 10.800 7.560 N Samd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081415.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.