Transcript: Mouse NM_001081971.1

Mus musculus ankyrin repeat domain 63 (Ankrd63), mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Ankrd63 (383787)
Length:
4861
CDS:
526..1698

Additional Resources:

NCBI RefSeq record:
NM_001081971.1
NBCI Gene record:
Ankrd63 (383787)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268143 CCTGAGAGTGGCCCAGAATTA pLKO_005 1591 CDS 100% 13.200 9.240 N Ankrd63 n/a
2 TRCN0000268188 TTGGTATTTCCCACGTAAATC pLKO_005 1878 3UTR 100% 13.200 9.240 N Ankrd63 n/a
3 TRCN0000268144 GAGTTCTTGGTGCGCTCTTTC pLKO_005 925 CDS 100% 10.800 7.560 N Ankrd63 n/a
4 TRCN0000268145 GTTATAGGGCACAAGGCAATG pLKO_005 1280 CDS 100% 6.000 4.200 N Ankrd63 n/a
5 TRCN0000283632 AGCTCTGATGGCTCGACCAAA pLKO_005 1380 CDS 100% 4.950 3.465 N Ankrd63 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.