Transcript: Mouse NM_001085509.2

Mus musculus myomesin family, member 3 (Myom3), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Myom3 (242702)
Length:
5578
CDS:
111..4430

Additional Resources:

NCBI RefSeq record:
NM_001085509.2
NBCI Gene record:
Myom3 (242702)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001085509.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253049 CTGGCATTGAGTGGGTTAATA pLKO_005 4859 3UTR 100% 15.000 21.000 N Myom3 n/a
2 TRCN0000253050 TCGGAGCTCCTGGGTTATTAC pLKO_005 1998 CDS 100% 13.200 18.480 N Myom3 n/a
3 TRCN0000253048 CAAAGTCCTCATCCGCAATTA pLKO_005 839 CDS 100% 13.200 9.240 N Myom3 n/a
4 TRCN0000253047 CGAACCGCAAGATCAACTTTG pLKO_005 3265 CDS 100% 10.800 7.560 N Myom3 n/a
5 TRCN0000253051 TGACTATGATGCAGTCCATAA pLKO_005 1517 CDS 100% 10.800 7.560 N Myom3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085509.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.