Transcript: Mouse NM_001085527.1

Mus musculus keratin associated protein 9-5 (Krtap9-5), mRNA.

Source:
NCBI, updated 2013-07-08
Taxon:
Mus musculus (mouse)
Gene:
Krtap9-5 (435286)
Length:
1077
CDS:
1..1077

Additional Resources:

NCBI RefSeq record:
NM_001085527.1
NBCI Gene record:
Krtap9-5 (435286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001085527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270269 CTGTAAGCCAACCAGTATAAA pLKO_005 141 CDS 100% 15.000 21.000 N Krtap9-5 n/a
2 TRCN0000270271 GACCACCTGCTGCTGTTATAA pLKO_005 276 CDS 100% 15.000 12.000 N Krtap9-5 n/a
3 TRCN0000270270 TGCTATAAGCCAACATGTATA pLKO_005 637 CDS 100% 13.200 10.560 N Krtap9-5 n/a
4 TRCN0000284221 CTGTAGGACCACCTGCTATAA pLKO_005 567 CDS 100% 13.200 9.240 N Krtap9-5 n/a
5 TRCN0000270272 TGTGAAACCACCTGCTATAAG pLKO_005 184 CDS 100% 13.200 9.240 N Krtap9-5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.