Transcript: Human NM_001093725.2

Homo sapiens mex-3 RNA binding family member A (MEX3A), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
MEX3A (92312)
Length:
6591
CDS:
468..2030

Additional Resources:

NCBI RefSeq record:
NM_001093725.2
NBCI Gene record:
MEX3A (92312)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001093725.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230494 CACGCAAGCCATCCGAATATT pLKO_005 2003 CDS 100% 15.000 21.000 N MEX3A n/a
2 TRCN0000230492 AGGCAAGGCTGCAAGATTAAG pLKO_005 915 CDS 100% 13.200 9.240 N MEX3A n/a
3 TRCN0000230493 CAAACCAACACATACATTATC pLKO_005 1221 CDS 100% 13.200 9.240 N MEX3A n/a
4 TRCN0000230491 AGCTCTGCGCTCTCTACAAAG pLKO_005 808 CDS 100% 10.800 7.560 N MEX3A n/a
5 TRCN0000218253 CTAGTGAAGACACGTACAAAT pLKO_005 6399 3UTR 100% 0.000 0.000 N MEX3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001093725.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.