Transcript: Mouse NM_001098636.1

Mus musculus PWWP domain containing 2B (Pwwp2b), transcript variant 1, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Pwwp2b (101631)
Length:
2640
CDS:
38..1840

Additional Resources:

NCBI RefSeq record:
NM_001098636.1
NBCI Gene record:
Pwwp2b (101631)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001098636.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238967 CGGACAGCCTGGATGAATTAA pLKO_005 1341 CDS 100% 15.000 10.500 N Pwwp2b n/a
2 TRCN0000238968 AGTCGCATCTCTTCCACATTC pLKO_005 2342 3UTR 100% 10.800 7.560 N Pwwp2b n/a
3 TRCN0000238965 CTCCCTTTCCACCATACTTTG pLKO_005 393 CDS 100% 10.800 7.560 N Pwwp2b n/a
4 TRCN0000238966 GGGATCCTGGAAGACTCATTC pLKO_005 525 CDS 100% 10.800 7.560 N Pwwp2b n/a
5 TRCN0000257096 AGGGTGAGGTGGTCAAGATTC pLKO_005 837 CDS 100% 10.800 6.480 N Pwwp2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098636.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.