Transcript: Human NM_001099289.3

Homo sapiens SH3 domain containing ring finger 3 (SH3RF3), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
SH3RF3 (344558)
Length:
5948
CDS:
337..2985

Additional Resources:

NCBI RefSeq record:
NM_001099289.3
NBCI Gene record:
SH3RF3 (344558)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001099289.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246302 TCGAGGAAGGGCCACTATAAT pLKO_005 4005 3UTR 100% 15.000 21.000 N SH3RF3 n/a
2 TRCN0000246301 AGGAAGGCGACATCGTCTTTG pLKO_005 2870 CDS 100% 10.800 15.120 N SH3RF3 n/a
3 TRCN0000246305 ATTTCGAGATGAAGGACAAAG pLKO_005 1133 CDS 100% 10.800 15.120 N SH3RF3 n/a
4 TRCN0000246303 GGCAGGCTCCTTGGATCTAAA pLKO_005 2718 CDS 100% 13.200 10.560 N SH3RF3 n/a
5 TRCN0000246304 CCTTCACCAAGGACGAGATTC pLKO_005 1175 CDS 100% 10.800 7.560 N SH3RF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099289.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.