Transcript: Human NM_001099293.3

Homo sapiens kinesin family member 4B (KIF4B), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
KIF4B (285643)
Length:
4387
CDS:
106..3810

Additional Resources:

NCBI RefSeq record:
NM_001099293.3
NBCI Gene record:
KIF4B (285643)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001099293.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253698 ACAACGAGAGGTCACAGATAA pLKO_005 2265 CDS 100% 13.200 10.560 N KIF4B n/a
2 TRCN0000253697 TGATCAAGTTCCTTCTTATTT pLKO_005 4090 3UTR 100% 15.000 10.500 N KIF4B n/a
3 TRCN0000253696 CCAAGCTGAACCAAGAGATAT pLKO_005 2006 CDS 100% 13.200 9.240 N KIF4B n/a
4 TRCN0000253695 GGCATTATTCCTAGGGTAATA pLKO_005 442 CDS 100% 13.200 9.240 N KIF4B n/a
5 TRCN0000265408 GCCATGGAAAGGAAGGTATTG pLKO_005 2303 CDS 100% 10.800 7.560 N KIF4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099293.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.