Transcript: Mouse NM_001099307.1

Mus musculus predicted gene 7173 (Gm7173), mRNA.

Source:
NCBI, updated 2016-06-24
Taxon:
Mus musculus (mouse)
Gene:
Gm7173 (636104)
Length:
2832
CDS:
1..2832

Additional Resources:

NCBI RefSeq record:
NM_001099307.1
NBCI Gene record:
Gm7173 (636104)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001099307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270961 CAATAGCCCTGAATCCATAAA pLKO_005 768 CDS 100% 13.200 10.560 N Gm7173 n/a
2 TRCN0000270959 AGATCACCAGAGGGCTTAAAT pLKO_005 2108 CDS 100% 15.000 10.500 N Gm7173 n/a
3 TRCN0000270886 CACATCAAATTGGAGTATTTA pLKO_005 1379 CDS 100% 15.000 10.500 N Gm7173 n/a
4 TRCN0000270958 GTGGTACAGTTAGGCTATATA pLKO_005 2561 CDS 100% 15.000 10.500 N Gm7173 n/a
5 TRCN0000270885 GAAGTTCAGCTGCGGGTAAAT pLKO_005 55 CDS 100% 13.200 9.240 N Gm7173 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.