Transcript: Mouse NM_001099323.2

Mus musculus zinc finger with KRAB and SCAN domains 16 (Zkscan16), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Zkscan16 (100041581)
Length:
2794
CDS:
159..2345

Additional Resources:

NCBI RefSeq record:
NM_001099323.2
NBCI Gene record:
Zkscan16 (100041581)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001099323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240371 TCAGATCGTGTGCTTATTTAA pLKO_005 2381 3UTR 100% 15.000 21.000 N Zkscan16 n/a
2 TRCN0000240375 GAAGCGTTTCGCCGAGTTATA pLKO_005 1625 CDS 100% 13.200 18.480 N Zkscan16 n/a
3 TRCN0000240374 ATCTCAAAGAGAGCTATATAA pLKO_005 725 CDS 100% 15.000 10.500 N Zkscan16 n/a
4 TRCN0000240372 GACAGAGTTCGTCGCTTAATT pLKO_005 2140 CDS 100% 15.000 10.500 N Zkscan16 n/a
5 TRCN0000240373 TTCAGCGACTACTCGTCATTT pLKO_005 1716 CDS 100% 13.200 7.920 N Zkscan16 n/a
6 TRCN0000239639 CAGGAGAGAAACCCTACAAAT pLKO_005 2179 CDS 100% 13.200 6.600 Y Zfp992 n/a
7 TRCN0000235191 ACTGGAGAGAAACCATATAAA pLKO_005 1758 CDS 100% 15.000 7.500 Y Gm4767 n/a
8 TRCN0000235210 ACTGGAGAGAAACCATATAAA pLKO_005 1758 CDS 100% 15.000 7.500 Y EG666477 n/a
9 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 2176 CDS 100% 10.800 5.400 Y Gm14308 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.