Transcript: Mouse NM_001099329.2

Mus musculus secretoglobin, family 1B, member 24 (Scgb1b24), mRNA.

Source:
NCBI, updated 2017-05-02
Taxon:
Mus musculus (mouse)
Gene:
Scgb1b24 (100043860)
Length:
400
CDS:
1..279

Additional Resources:

NCBI RefSeq record:
NM_001099329.2
NBCI Gene record:
Scgb1b24 (100043860)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001099329.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284630 ATACAAAGACGATCCTGAAAT pLKO_005 147 CDS 100% 13.200 9.240 N Scgb1b24 n/a
2 TRCN0000281862 GATCAAGAAATGTGTCGATAG pLKO_005 186 CDS 100% 6.000 4.200 N Scgb1b24 n/a
3 TRCN0000272150 CAGGATGTTCATCTATTCTTT pLKO_005 88 CDS 100% 5.625 3.938 N Scgb1b24 n/a
4 TRCN0000272151 AGTATGTTGAATATGTGAAAC pLKO_005 125 CDS 100% 10.800 6.480 N Scgb1b24 n/a
5 TRCN0000284632 TGGCATTTGCCCAGCTATAAA pLKO_005 66 CDS 100% 15.000 7.500 Y Scgb1b24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099329.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.