Transcript: Mouse NM_001099631.1

Mus musculus SH2 domain containing 5 (Sh2d5), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Sh2d5 (230863)
Length:
3158
CDS:
140..1429

Additional Resources:

NCBI RefSeq record:
NM_001099631.1
NBCI Gene record:
Sh2d5 (230863)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001099631.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252084 GAGAGGTCCATATCCTGTATC pLKO_005 525 CDS 100% 10.800 15.120 N Sh2d5 n/a
2 TRCN0000252085 CAGTGGAGAACTAGGATTAAT pLKO_005 1996 3UTR 100% 15.000 10.500 N Sh2d5 n/a
3 TRCN0000252087 TTGCCAAGCTTGCCCAGTATG pLKO_005 210 CDS 100% 10.800 7.560 N Sh2d5 n/a
4 TRCN0000252086 TTCAGGGTCTCAAGATCTACA pLKO_005 348 CDS 100% 4.950 3.465 N Sh2d5 n/a
5 TRCN0000252083 CTCAACCCTACCTACGAAGAG pLKO_005 1319 CDS 100% 4.050 2.835 N Sh2d5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099631.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.