Transcript: Mouse NM_001100394.1

Mus musculus RIKEN cDNA 4930505A04 gene (4930505A04Rik), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
4930505A04Rik (75087)
Length:
944
CDS:
66..767

Additional Resources:

NCBI RefSeq record:
NM_001100394.1
NBCI Gene record:
4930505A04Rik (75087)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001100394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267841 TCCTAAGGCACCGGAGGTATT pLKO_005 620 CDS 100% 10.800 15.120 N 4930505A04Rik n/a
2 TRCN0000267796 CATGTCTCCCAACCATCTTAT pLKO_005 330 CDS 100% 13.200 10.560 N 4930505A04Rik n/a
3 TRCN0000267840 TGTGGACAGAAGACGTGTAAA pLKO_005 194 CDS 100% 13.200 9.240 N 4930505A04Rik n/a
4 TRCN0000267798 ACGAGCCAGTTCCCTACATTG pLKO_005 253 CDS 100% 10.800 7.560 N 4930505A04Rik n/a
5 TRCN0000283556 ACAGCTTATCAGCACGAGAAG pLKO_005 769 3UTR 100% 4.050 2.835 N 4930505A04Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001100394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.