Transcript: Mouse NM_001101479.1

Mus musculus poly(A) binding protein, cytoplasmic 4-like (Pabpc4l), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Pabpc4l (241989)
Length:
5218
CDS:
208..1320

Additional Resources:

NCBI RefSeq record:
NM_001101479.1
NBCI Gene record:
Pabpc4l (241989)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001101479.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251815 ATGGATATGTCTGCGTTATTT pLKO_005 4612 3UTR 100% 15.000 21.000 N Pabpc4l n/a
2 TRCN0000251817 GAACGACAGGCTGAGTTAAAG pLKO_005 1015 CDS 100% 13.200 18.480 N Pabpc4l n/a
3 TRCN0000251816 TTGACGTGATCAAAGGTAAAT pLKO_005 425 CDS 100% 13.200 10.560 N Pabpc4l n/a
4 TRCN0000265244 TAGGCTACGCCTATGTCAATT pLKO_005 359 CDS 100% 13.200 9.240 N Pabpc4l n/a
5 TRCN0000251814 TCTGGACAAATCCATTGATAA pLKO_005 519 CDS 100% 13.200 9.240 N Pabpc4l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101479.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.