Transcript: Mouse NM_001101507.1

Mus musculus C-type lectin domain family 2, member L (Clec2l), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Clec2l (665180)
Length:
1445
CDS:
168..803

Additional Resources:

NCBI RefSeq record:
NM_001101507.1
NBCI Gene record:
Clec2l (665180)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001101507.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240288 CTGTGGCCTAGCAGTTATATC pLKO_005 997 3UTR 100% 13.200 9.240 N Clec2l n/a
2 TRCN0000240289 CCGTTTGACCCAGACACATTC pLKO_005 675 CDS 100% 10.800 7.560 N Clec2l n/a
3 TRCN0000239626 GTGCAGCAAGATGGCCTATAC pLKO_005 779 CDS 100% 10.800 7.560 N CLEC2L n/a
4 TRCN0000240287 GTGCAGCAAGATGGCCTATAC pLKO_005 779 CDS 100% 10.800 7.560 N Clec2l n/a
5 TRCN0000218810 CAGAAGGAACTGGAATTTATG pLKO_005 579 CDS 100% 13.200 7.920 N Clec2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101507.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.