Transcript: Mouse NM_001101510.1

Mus musculus sushi domain containing 5 (Susd5), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Susd5 (382111)
Length:
3874
CDS:
192..2051

Additional Resources:

NCBI RefSeq record:
NM_001101510.1
NBCI Gene record:
Susd5 (382111)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001101510.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251597 ACGTAAGTAGATGGTATTAAT pLKO_005 3540 3UTR 100% 15.000 21.000 N Susd5 n/a
2 TRCN0000251593 ACCCTCCAGCCGACACATAAA pLKO_005 1665 CDS 100% 13.200 18.480 N Susd5 n/a
3 TRCN0000251596 CACCTAGTGAATCCGTGATAC pLKO_005 1435 CDS 100% 10.800 15.120 N Susd5 n/a
4 TRCN0000251594 CCATACCAGGGATGTTGATTC pLKO_005 1538 CDS 100% 10.800 15.120 N Susd5 n/a
5 TRCN0000251595 CTCGATCAGTCCATCTCAAAT pLKO_005 1460 CDS 100% 13.200 9.240 N Susd5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101510.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.