Transcript: Mouse NM_001101531.1

Mus musculus predicted gene 5538 (Gm5538), mRNA.

Source:
NCBI, updated 2013-04-18
Taxon:
Mus musculus (mouse)
Gene:
Gm5538 (433597)
Length:
1303
CDS:
34..1239

Additional Resources:

NCBI RefSeq record:
NM_001101531.1
NBCI Gene record:
Gm5538 (433597)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001101531.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265589 GTTTGAAATCATGGGTCTTAT pLKO_005 180 CDS 100% 13.200 18.480 N Gm5538 n/a
2 TRCN0000254630 CTGTATTCTCTTTGCTTATTA pLKO_005 66 CDS 100% 15.000 10.500 N Gm5538 n/a
3 TRCN0000254628 GGCAACAACAGCAATTCAATT pLKO_005 615 CDS 100% 13.200 9.240 N Gm5538 n/a
4 TRCN0000254629 TAATCCAGAACACAAAGATAA pLKO_005 645 CDS 100% 13.200 7.920 N Gm5538 n/a
5 TRCN0000254631 TTTCAAGGGAGATAGCAATTA pLKO_005 755 CDS 100% 13.200 7.920 N Gm5538 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101531.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.