Transcript: Mouse NM_001101603.1

Mus musculus predicted gene 8439 (Gm8439), mRNA.

Source:
NCBI, updated 2015-09-25
Taxon:
Mus musculus (mouse)
Gene:
Gm8439 (667063)
Length:
420
CDS:
61..351

Additional Resources:

NCBI RefSeq record:
NM_001101603.1
NBCI Gene record:
Gm8439 (667063)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001101603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271089 CAAGGCGATTGCTACTCAAGA pLKO_005 129 CDS 100% 4.950 6.930 N Gm8439 n/a
2 TRCN0000271022 GAGTGCTGACTCCCAGAAGAT pLKO_005 188 CDS 100% 4.950 3.465 N Gm8439 n/a
3 TRCN0000271087 TCTGACCACCACAACACAGAT pLKO_005 213 CDS 100% 4.950 3.465 N Gm8439 n/a
4 TRCN0000271021 GTCCAGAGAGGTTGCCGTTGT pLKO_005 238 CDS 100% 1.350 0.945 N Gm8439 n/a
5 TRCN0000271088 TCCTGAGGTGGAGTCAGTGAG pLKO_005 102 CDS 100% 1.350 0.945 N Gm8439 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.