Transcript: Human NM_001102562.3

Homo sapiens membrane associated ring-CH-type finger 11 (MARCHF11), mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
MARCHF11 (441061)
Length:
1757
CDS:
217..1425

Additional Resources:

NCBI RefSeq record:
NM_001102562.3
NBCI Gene record:
MARCHF11 (441061)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001102562.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265614 GATACCATGTTATAGCCATTA pLKO_005 869 CDS 100% 10.800 8.640 N MARCHF11 n/a
2 TRCN0000254736 TCCTAGGATCCCTGTTCTTAA pLKO_005 962 CDS 100% 13.200 9.240 N MARCHF11 n/a
3 TRCN0000254735 ATTTGCACTGGGATGTGTTAA pLKO_005 1163 CDS 100% 13.200 7.920 N MARCHF11 n/a
4 TRCN0000265596 AGCCACAGACATCGAAGAAAG pLKO_005 1194 CDS 100% 10.800 6.480 N MARCHF11 n/a
5 TRCN0000254737 GTGATGGGTCAGTTCGGTATA pLKO_005 779 CDS 100% 10.800 6.480 N MARCHF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001102562.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.