Transcript: Human NM_001103160.2

Homo sapiens SH2 domain containing 5 (SH2D5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SH2D5 (400745)
Length:
3769
CDS:
689..1708

Additional Resources:

NCBI RefSeq record:
NM_001103160.2
NBCI Gene record:
SH2D5 (400745)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001103160.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245828 GGAGTTGCAGGCTTCGGATAA pLKO_005 1934 3UTR 100% 10.800 15.120 N SH2D5 n/a
2 TRCN0000245830 GGTTACTGAACGTAGCCTCTT pLKO_005 1555 CDS 100% 4.050 5.670 N SH2D5 n/a
3 TRCN0000245826 TTTGCCTTCATGGCTCGAAAC pLKO_005 746 CDS 100% 6.000 4.800 N SH2D5 n/a
4 TRCN0000245827 AGCTCTTCTGCCACCTCTTTG pLKO_005 786 CDS 100% 10.800 7.560 N SH2D5 n/a
5 TRCN0000252086 TTCAGGGTCTCAAGATCTACA pLKO_005 645 5UTR 100% 4.950 3.465 N Sh2d5 n/a
6 TRCN0000245829 AGCTCTCTCAGAACGTCCATG pLKO_005 996 CDS 100% 4.050 2.835 N SH2D5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001103160.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.