Transcript: Human NM_001105571.3

Homo sapiens dehydrogenase/reductase 7C (DHRS7C), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
DHRS7C (201140)
Length:
1294
CDS:
309..1244

Additional Resources:

NCBI RefSeq record:
NM_001105571.3
NBCI Gene record:
DHRS7C (201140)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001105571.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245767 ATCCCGTTCCGTACGACTTAC pLKO_005 861 CDS 100% 10.800 15.120 N DHRS7C n/a
2 TRCN0000245766 GAACAGGCCAAATCGTGTTAG pLKO_005 814 CDS 100% 10.800 15.120 N DHRS7C n/a
3 TRCN0000245768 AGAGGCTAGAGAACCTATATG pLKO_005 523 CDS 100% 13.200 9.240 N DHRS7C n/a
4 TRCN0000245765 GAAACTGGGAAGCTTCCATTT pLKO_005 1009 CDS 100% 10.800 7.560 N DHRS7C n/a
5 TRCN0000245769 GAAGAAGCAAGAGGTGTTTAT pLKO_005 1109 CDS 100% 13.200 7.920 N DHRS7C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001105571.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.