Transcript: Human NM_001114403.3

Homo sapiens uroplakin 3B like 1 (UPK3BL1), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
UPK3BL1 (100134938)
Length:
1342
CDS:
51..842

Additional Resources:

NCBI RefSeq record:
NM_001114403.3
NBCI Gene record:
UPK3BL1 (100134938)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001114403.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337351 CCTCCTGGCTGTGCTCATATA pLKO_005 707 CDS 100% 13.200 6.600 Y UPK3BL1 n/a
2 TRCN0000337349 ATCATCGCCATCCTGTCTATC pLKO_005 663 CDS 100% 10.800 5.400 Y UPK3BL1 n/a
3 TRCN0000337418 CCTCACGGGTTCAAGCGATTT pLKO_005 1040 3UTR 100% 10.800 5.400 Y UPK3BL1 n/a
4 TRCN0000337420 GCAGGGAGTGTGAGAAGATAC pLKO_005 777 CDS 100% 10.800 5.400 Y UPK3BL1 n/a
5 TRCN0000337352 TGAAGTTCCTGGTGATGAATG pLKO_005 538 CDS 100% 10.800 5.400 Y UPK3BL1 n/a
6 TRCN0000419248 AGTTCAGCAGCCACAACATCT pLKO_005 262 CDS 100% 4.950 2.475 Y POLR2J2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114403.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.