Transcript: Human NM_001114748.2

Homo sapiens transmembrane protein 240 (TMEM240), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TMEM240 (339453)
Length:
1381
CDS:
279..800

Additional Resources:

NCBI RefSeq record:
NM_001114748.2
NBCI Gene record:
TMEM240 (339453)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001114748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264127 ACGCCTCCGAGAACTACTTTG pLKO_005 493 CDS 100% 10.800 15.120 N TMEM240 n/a
2 TRCN0000264128 ACCATATCCACTACGTGATCC pLKO_005 445 CDS 100% 4.050 5.670 N TMEM240 n/a
3 TRCN0000264126 AGCAGAAACTCTACCACAATG pLKO_005 754 CDS 100% 10.800 7.560 N TMEM240 n/a
4 TRCN0000264125 TCTGTTTGAAGGCGCTGTTTC pLKO_005 1157 3UTR 100% 10.800 7.560 N TMEM240 n/a
5 TRCN0000264124 TCGCGTGCTTGATGGACATGA pLKO_005 340 CDS 100% 4.950 3.465 N TMEM240 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.