Transcript: Mouse NM_001115077.1

Mus musculus PRAME family member 20 (Pramef20), mRNA.

Source:
NCBI, updated 2017-05-17
Taxon:
Mus musculus (mouse)
Gene:
Pramef20 (627009)
Length:
1434
CDS:
1..1434

Additional Resources:

NCBI RefSeq record:
NM_001115077.1
NBCI Gene record:
Pramef20 (627009)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001115077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270693 CCTACTTGGAGACTCAATTAC pLKO_005 221 CDS 100% 13.200 18.480 N Pramef20 n/a
2 TRCN0000284447 GTCTTAGAGGAGGTTGATAAG pLKO_005 247 CDS 100% 10.800 15.120 N Pramef20 n/a
3 TRCN0000270637 TCAGCGCTTTGCAGTACTTAC pLKO_005 74 CDS 100% 10.800 15.120 N Pramef20 n/a
4 TRCN0000270692 CTACGATGGTAACCATCTTAA pLKO_005 129 CDS 100% 13.200 9.240 N Pramef20 n/a
5 TRCN0000270636 ATAGGAGGAAAGGGTTGTTAC pLKO_005 509 CDS 100% 10.800 7.560 N Pramef20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001115077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.