Transcript: Mouse NM_001122603.1

Mus musculus Fc fragment of IgG binding protein (Fcgbp), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Fcgbp (215384)
Length:
7957
CDS:
20..7771

Additional Resources:

NCBI RefSeq record:
NM_001122603.1
NBCI Gene record:
Fcgbp (215384)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001122603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254024 GTGTCCATAACGGCCAATATA pLKO_005 7080 CDS 100% 15.000 21.000 N Fcgbp n/a
2 TRCN0000254021 CTATCGTGAGCATAGACTTTG pLKO_005 1677 CDS 100% 10.800 15.120 N Fcgbp n/a
3 TRCN0000254023 TCGTGATTGAAACCGACTTTG pLKO_005 2838 CDS 100% 10.800 15.120 N Fcgbp n/a
4 TRCN0000254025 CCACTCTCAACACCAACATTT pLKO_005 3972 CDS 100% 13.200 9.240 N Fcgbp n/a
5 TRCN0000254022 CTGGCACTGAAGGCATCAAGA pLKO_005 7782 3UTR 100% 4.950 2.475 Y Fcgbp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.