Transcript: Human NM_001129890.1

Homo sapiens leucine rich repeat containing 69 (LRRC69), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
LRRC69 (100130742)
Length:
1323
CDS:
44..1087

Additional Resources:

NCBI RefSeq record:
NM_001129890.1
NBCI Gene record:
LRRC69 (100130742)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001129890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344483 CACAGATTATGCCCTACTTAA pLKO_005 1144 3UTR 100% 13.200 18.480 N LRRC69 n/a
2 TRCN0000255417 GTTCCGGAAGAGATGAAATAT pLKO_005 266 CDS 100% 15.000 10.500 N LRRC69 n/a
3 TRCN0000255418 CTTGTTGAACTTCAACTTAAC pLKO_005 506 CDS 100% 10.800 7.560 N LRRC69 n/a
4 TRCN0000344442 CATACCTGAAGAGATTAAATT pLKO_005 544 CDS 100% 15.000 9.000 N LRRC69 n/a
5 TRCN0000255416 TGGTGCCTCTCCAAGTATTAA pLKO_005 1005 CDS 100% 15.000 7.500 Y LRRC69 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001129890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.