Transcript: Human NM_001129908.3

Homo sapiens golgi associated kinase 1A (GASK1A), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
GASK1A (729085)
Length:
3389
CDS:
333..2060

Additional Resources:

NCBI RefSeq record:
NM_001129908.3
NBCI Gene record:
GASK1A (729085)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001129908.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281730 CACCTGGTCTACATCGATAAC pLKO_005 1767 CDS 100% 10.800 15.120 N GASK1A n/a
2 TRCN0000269669 TCTCGCATCAGGGTGTCTACA pLKO_005 1874 CDS 100% 4.950 6.930 N GASK1A n/a
3 TRCN0000269717 CAAGGATGTCACGGGATATTT pLKO_005 2165 3UTR 100% 15.000 10.500 N GASK1A n/a
4 TRCN0000284234 GTGAGGAGGGACATTACTTTG pLKO_005 684 CDS 100% 10.800 7.560 N GASK1A n/a
5 TRCN0000284075 TTCAGGGACGAGGACCCATAA pLKO_005 2040 CDS 100% 10.800 6.480 N GASK1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001129908.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.