Transcript: Mouse NM_001135577.2

Mus musculus small integral membrane protein 13 (Smim13), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Smim13 (108934)
Length:
4499
CDS:
396..662

Additional Resources:

NCBI RefSeq record:
NM_001135577.2
NBCI Gene record:
Smim13 (108934)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001135577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254186 GATGGTGTGCGGTTGGTATTT pLKO_005 461 CDS 100% 13.200 18.480 N Smim13 n/a
2 TRCN0000254187 TTGACGAAGCCATGCTATATT pLKO_005 1412 3UTR 100% 15.000 10.500 N Smim13 n/a
3 TRCN0000254184 GAAGAAGACCCTTCGGCTTCA pLKO_005 585 CDS 100% 4.050 2.835 N Smim13 n/a
4 TRCN0000265478 TCAAGTTTCTTCGGGAGCTTG pLKO_005 508 CDS 100% 4.050 2.835 N Smim13 n/a
5 TRCN0000254185 GATCCCAGGAAGGAGATAATG pLKO_005 541 CDS 100% 13.200 7.920 N Smim13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.