Transcript: Human NM_001136566.2

Homo sapiens RAD21 cohesin complex component like 1 (RAD21L1), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
RAD21L1 (642636)
Length:
1808
CDS:
94..1764

Additional Resources:

NCBI RefSeq record:
NM_001136566.2
NBCI Gene record:
RAD21L1 (642636)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136566.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337217 TCTCATGAGGATACCAATAAA pLKO_005 1366 CDS 100% 15.000 21.000 N RAD21L1 n/a
2 TRCN0000337219 TACCCTTGATCCAATTGATAT pLKO_005 924 CDS 100% 0.000 0.000 N RAD21L1 n/a
3 TRCN0000350851 CATGATGCAAGAGCCAAATTA pLKO_005 1284 CDS 100% 15.000 12.000 N RAD21L1 n/a
4 TRCN0000337154 GAAATGATTGACAATCTATTG pLKO_005 730 CDS 100% 10.800 7.560 N RAD21L1 n/a
5 TRCN0000337218 GGGAGTTGTTCGAATCTATAA pLKO_005 276 CDS 100% 13.200 7.920 N RAD21L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136566.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.