Transcript: Human NM_001144871.2

Homo sapiens V-set and transmembrane domain containing 5 (VSTM5), mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
VSTM5 (387804)
Length:
3056
CDS:
117..719

Additional Resources:

NCBI RefSeq record:
NM_001144871.2
NBCI Gene record:
VSTM5 (387804)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352395 CACCATCGAATGGACATATTC pLKO_005 305 CDS 100% 13.200 9.240 N VSTM5 n/a
2 TRCN0000352350 TGAGGGATTCCGGCTACTATG pLKO_005 451 CDS 100% 10.800 7.560 N VSTM5 n/a
3 TRCN0000370813 AGGCATCTCCCTAGGACTCTT pLKO_005 152 CDS 100% 4.950 3.465 N VSTM5 n/a
4 TRCN0000370875 CTCTATGAAGACCTGCACTTT pLKO_005 540 CDS 100% 4.950 3.465 N VSTM5 n/a
5 TRCN0000352411 CCTGCTCTCAGTTGAGTACTC pLKO_005 269 CDS 100% 4.050 2.835 N VSTM5 n/a
6 TRCN0000370812 GAACGCAGAAGATCGTGGAGT pLKO_005 337 CDS 100% 2.640 1.848 N VSTM5 n/a
7 TRCN0000352334 TTCCTCAGGCCACCATCAATG pLKO_005 229 CDS 100% 10.800 6.480 N VSTM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.