Transcript: Human NM_001144990.2

Homo sapiens NACHT and WD repeat domain containing 2 (NWD2), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
NWD2 (57495)
Length:
7800
CDS:
326..5554

Additional Resources:

NCBI RefSeq record:
NM_001144990.2
NBCI Gene record:
NWD2 (57495)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144990.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336927 ACACCATCTTAGCAGATTATT pLKO_005 2592 CDS 100% 15.000 21.000 N NWD2 n/a
2 TRCN0000336924 TAACATCCACCGGAGATATAA pLKO_005 4419 CDS 100% 15.000 21.000 N NWD2 n/a
3 TRCN0000336926 GTCCTGATATCATCGTGTTTA pLKO_005 4794 CDS 100% 13.200 10.560 N NWD2 n/a
4 TRCN0000336868 GGAACAGAACCGAGGATTATT pLKO_005 1172 CDS 100% 15.000 10.500 N NWD2 n/a
5 TRCN0000350773 GTGTGGTGAGGCAGCATAATA pLKO_005 5824 3UTR 100% 15.000 10.500 N NWD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144990.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.