Transcript: Mouse NM_001145978.2

Mus musculus poly (ADP-ribose) polymerase family, member 4 (Parp4), mRNA.

Source:
NCBI, updated 2016-07-26
Taxon:
Mus musculus (mouse)
Gene:
Parp4 (328417)
Length:
6391
CDS:
114..6023

Additional Resources:

NCBI RefSeq record:
NM_001145978.2
NBCI Gene record:
Parp4 (328417)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001145978.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238878 AGTGGAGACAATTCGTATAAA pLKO_005 2396 CDS 100% 15.000 21.000 N Parp4 n/a
2 TRCN0000238877 AGCCTGAATGACGTGAGTAAA pLKO_005 960 CDS 100% 13.200 18.480 N Parp4 n/a
3 TRCN0000238875 AGTGCATCAGAGCCCTAATAA pLKO_005 5303 CDS 100% 15.000 10.500 N Parp4 n/a
4 TRCN0000238876 TGGAAAGTTCTCCGCTATTTA pLKO_005 2952 CDS 100% 15.000 10.500 N Parp4 n/a
5 TRCN0000238874 CACCACTGCTCTGATGCCTTT pLKO_005 6217 3UTR 100% 4.050 2.835 N Parp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145978.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.