Transcript: Human NM_001146188.2

Homo sapiens TOX high mobility group box family member 3 (TOX3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
TOX3 (27324)
Length:
4713
CDS:
189..1904

Additional Resources:

NCBI RefSeq record:
NM_001146188.2
NBCI Gene record:
TOX3 (27324)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426734 TGTCTATTAGATAGGCAATAA pLKO_005 2036 3UTR 100% 13.200 18.480 N Tox3 n/a
2 TRCN0000237900 CCAACATGCCCTCGAACATTG pLKO_005 1387 CDS 100% 10.800 15.120 N TOX3 n/a
3 TRCN0000237899 GACACACAGGCTGCAATTAAA pLKO_005 975 CDS 100% 15.000 10.500 N TOX3 n/a
4 TRCN0000237902 GACCACTGTTAGCCCATTATA pLKO_005 2579 3UTR 100% 15.000 10.500 N TOX3 n/a
5 TRCN0000237903 CAGACACAGACTCAAGTATTA pLKO_005 1863 CDS 100% 13.200 9.240 N TOX3 n/a
6 TRCN0000237901 GGGACATACTGATGACTATAA pLKO_005 2205 3UTR 100% 13.200 9.240 N TOX3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.