Transcript: Human NM_001146197.3

Homo sapiens coiled-coil domain containing 168 (CCDC168), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CCDC168 (643677)
Length:
21470
CDS:
141..21386

Additional Resources:

NCBI RefSeq record:
NM_001146197.3
NBCI Gene record:
CCDC168 (643677)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146197.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337227 CAGACGCAAACACCAATATAA pLKO_005 17959 CDS 100% 15.000 21.000 N CCDC168 n/a
2 TRCN0000350792 AGCAATCAAAGTTGGATATTA pLKO_005 9604 CDS 100% 15.000 10.500 N CCDC168 n/a
3 TRCN0000337284 ATCATCTGCAGAGTCAATTAA pLKO_005 11444 CDS 100% 15.000 10.500 N CCDC168 n/a
4 TRCN0000337283 ATTATCAGAAGGAGGTAATTT pLKO_005 10418 CDS 100% 15.000 10.500 N CCDC168 n/a
5 TRCN0000350791 TGCCCTCTTGCCCACTTATTT pLKO_005 840 CDS 100% 15.000 10.500 N CCDC168 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146197.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.