Transcript: Mouse NM_001160319.1

Mus musculus ubiquitin protein ligase E3 component n-recognin 4 (Ubr4), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Ubr4 (69116)
Length:
15901
CDS:
29..15571

Additional Resources:

NCBI RefSeq record:
NM_001160319.1
NBCI Gene record:
Ubr4 (69116)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001160319.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341873 CACGAAGGTCTTAGGCATTTA pLKO_005 14566 CDS 100% 13.200 18.480 N Ubr4 n/a
2 TRCN0000341874 GAGAGCTCTCCTCGGGTTAAA pLKO_005 1880 CDS 100% 13.200 18.480 N Ubr4 n/a
3 TRCN0000341941 GATGCCCGGAAACCCATATAG pLKO_005 13117 CDS 100% 13.200 18.480 N Ubr4 n/a
4 TRCN0000341943 CCGACTCCAACACGTACTATG pLKO_005 1719 CDS 100% 10.800 15.120 N Ubr4 n/a
5 TRCN0000341872 TCTCTCCGTGTGCACTCATTT pLKO_005 15623 3UTR 100% 13.200 10.560 N Ubr4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001160319.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.