Transcript: Mouse NM_001162943.1

Mus musculus dachsous 1 (Drosophila) (Dchs1), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Dchs1 (233651)
Length:
10651
CDS:
307..10182

Additional Resources:

NCBI RefSeq record:
NM_001162943.1
NBCI Gene record:
Dchs1 (233651)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001162943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341730 CGTGAGTCCCAGGAGTTATAC pLKO_005 3472 CDS 100% 13.200 18.480 N Dchs1 n/a
2 TRCN0000341802 TGTCGCTGTGCTCGATCTTAA pLKO_005 3882 CDS 100% 13.200 10.560 N Dchs1 n/a
3 TRCN0000341731 ATTCACCCTCAGGGCTATTAA pLKO_005 2807 CDS 100% 15.000 10.500 N Dchs1 n/a
4 TRCN0000341732 CTCGGACCATGACTGACTATG pLKO_005 10264 3UTR 100% 10.800 7.560 N Dchs1 n/a
5 TRCN0000341733 TCCGCATGATCAACGAGTTTC pLKO_005 9416 CDS 100% 10.800 7.560 N Dchs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001162943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.